• Users Online: 146
  • Home
  • Print this page
  • Email this page
Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 


 
 Table of Contents  
ORIGINAL ARTICLE
Year : 2020  |  Volume : 20  |  Issue : 3  |  Page : 151-156

Evaluation of chemokine receptor 2 polymorphism in patients with end-stage renal disease


1 Assistant Professor of Clinical and Chemical Pathology, Health Radiation Research Department, National Center for Radiation Research and Technology, Atomic Energy Authority, Cairo, Egypt
2 Assisstant Professor of Nephrology and Internal Medicine, Depatment of Internal Medicine, Faculty of Medicine, Cairo University, Cairo, Egypt
3 Professor of Public Health, Department of Enviromental Sciences Research, National Research Center, Cairo, Egypt

Date of Submission25-Jan-2020
Date of Acceptance13-May-2020
Date of Web Publication17-Jul-2020

Correspondence Address:
Dr. Manal M Alkady
Department of Health Radiation Research, National Center for Radiation Research and Technology, Atomic Energy Authority, P.O. Box 29, Nasr City, Cairo
Egypt
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jesnt.jesnt_2_20

Rights and Permissions
  Abstract 


Background The inflammatory state accompanying end-stage renal disease (ESRD) is hallmarked by renal infiltration of monocytes/macrophages, which are the major source of chemokines and chemokine receptors. We aimed to determine the frequency and association of chemokine receptor 2 (CCR2)-V64I polymorphism in patients with ESRD.
Patients and methods A total of 35 patients attending the hemodialysis unit and 21 healthy controls were recruited in this study. The PCR-restriction fragment length polymorphism technique was used to assess genotype frequencies of CCR2-V64I.
Results The frequency of genotypes GG, AG, and AA in patient group was 65.7, 25.7, and 8.6%, respectively, in comparison with 81.0, 14.3, and 4.8%, respectively, in the control group. Therefore, the patient group showed higher frequency of AG and AA genotypes and a lower frequency of GG genotype than the control group but this difference was not significant. The frequencies of A and G alleles did not show a significant difference between the two groups. The frequencies of G and A alleles were 78.6 and 21.4%, respectively, in the patient group in comparison with 88.1 and 11.9%, respectively, in the controls. Patients carrying the genotypes AA and G/A showed rapid progression to ESRD than those with genotype G/G. No significant association was found between the occurrence of polymorphism and the presence of hypertension or diabetes mellitus.
Conclusion The CCR2-V64I gene polymorphism may play a role in the pathogenesis and severity of ESRD in Egyptian patients. To uncover this role, further analyses should be carried out on larger population-based studies.

Keywords: chemokine receptor 2, end-stage renal disease, PCR-restriction fragment length polymorphism, polymorphism


How to cite this article:
Alkady MM, Abdel-Messeih PL, El-Fishawy HS, Eltahlawy EM. Evaluation of chemokine receptor 2 polymorphism in patients with end-stage renal disease. J Egypt Soc Nephrol Transplant 2020;20:151-6

How to cite this URL:
Alkady MM, Abdel-Messeih PL, El-Fishawy HS, Eltahlawy EM. Evaluation of chemokine receptor 2 polymorphism in patients with end-stage renal disease. J Egypt Soc Nephrol Transplant [serial online] 2020 [cited 2020 Oct 20];20:151-6. Available from: http://www.jesnt.eg.net/text.asp?2020/20/3/151/290011




  Introduction Top


‘Chemokine’ is the abbreviation of ‘chemotactic cytokine,’ which refers to a large family of small cytokines or signaling proteins that, as soon as it is attached to its receptors on leukocytes it stimulates their movement and regulates their migration from blood to tissues [1]. Additional enrollment of leukocytes is related to their attachment to the endothelial cells with overexpression of pro-inflammatory mediators, for example, reactive oxygen species, lysosomal enzymes, and nitric oxide along with vascular endothelial growth factor and transforming growth factor-beta. The latter inflammatory mediators play crucial roles in the occurrence and progression of both innate and graft kidney damage [2].

Chemokines can be categorized into four main subfamilies (CXC, CC, CX3C, and XC) according to their amino acid composition [3]. Chemokines exercise their biological properties by binding to transmembrane receptors (chemokine receptors). The chemokine CCL2 is an inflammatory chemokine also referred to as monocyte chemotactic protein 1 (MCP-1) [4]. The chemokine CCL2 and its principal receptor chemokine receptor 2 (CCR2) promotes the pathogenesis of many different disease processes [5]. The CCR2 gene is present on the chromosome 3p21 in the chemokine receptor gene cluster region. Numerous polymorphisms could be detected in the CCR2 gene. The polymorphism CCR2-V64I changes the amino acid valine at codon 64 in the transmembrane domain of the CCR2 protein to isoleucine, which results from a single nucleotide polymorphism (SNP) of guanine to adenine at position 190 of the CCR2 gene [6].

End-stage renal disease (ESRD) is associated with an inflammatory state owing to infiltrating macrophages/lymphocytes, a major source of chemokines [7]. Chronic kidney disease (CKD) is considered a public health problem whose incidence and prevalence have risen gradually during the past few years. CKD progression causes premature morbidity and mortality [8]. All the mechanisms that bring about the pathogenesis of CKD lead to a progressive loss of renal function owing to tubulointerstitial fibrosis, interstitial capillary damage with hypoxia, destruction of renal tubules, and loss of functioning nephrons [9]. Locally released chemokines contribute to the renal damage in CKD via inflammatory and pro-fibrotic factors [10]. Discontinuing the chemokine signal is vital to alleviate the inflammatory process [11].

The aim of the present study was to determine the frequency and the possible role of CCR2-V64I gene polymorphism in Egyptian patients with ESRD and to explore their association with the disease and disease severity.


  Patients and methods Top


Patient selection

The present study was performed on 35 patients (27 males/eight females) with ESRD, enrolled in the study from those attending the hemodialysis unit three times per week at Cairo University in the period from May to September 2018 and categorized as having chronic renal insufficiency with serum creatinine more than 3 mg/dl. Sample size was calculated according to previous studies [12],[13]. Patients were either diabetics or hypertensive or both, aged between 40 and 60 years, with a mean age of 47.5±11.1 years. The control group consisted of 21 healthy participants (15 males/six females), with their mean age being 48.2±10 years. They underwent their routine visits at the preventive health service on the same day as that of the patients. They were healthy volunteers with normal fasting glucose levels, normal blood pressure, normal blood lipids, and normal kidney functions. Patients with obstructive renal disease, renal stone disease, and acute urinary tract infection were excluded from this study.

All procedures performed in the study were in accordance with the ethical standards of the institutional and national research committee and with the 1964 Helsinki declaration as revised in 2013. A written informal consent of participation in the study was taken from all participants. This study was approved by the Committee of Ethics and Research of the university hospital and the National center for radiation research and technology.

All patients and controls were subjected to full history taking and clinical examination. The date of diagnosis of the renal disease and the time of onset of ESRD were available.

Assessment of kidney function parameters such as glomerular filtration rate and effective renal plasma flow was done with 18F-fluorodeoxyglucose positron emission tomography.

Overall, 6 ml of peripheral blood samples was obtained from all patients and controls after 10 h of overnight fasting; 2 ml of blood was transferred into plain tubes for the measurement of serum creatinine and other biochemical parameters and 4 ml of blood was transferred into EDTA containing tubes for extraction of genomic DNA and genotyping.

Extraction of genomic DNA and chemokine receptor 2-V64Il genotyping

From the buffy coat, genomic DNA was extracted using the Invitek kit extraction technique (Qiagen, S.A. 3 avenue du, Canada) according to the manufacturer’s instructions and stored at −20°C until assay. Determination of CCR2-V64I genotype was done by PCR followed by restriction fragment length polymorphism detection using the specific primers and restriction endonucleases. The fragment (380 bp) of CCR2 gene was amplified by the primers. The two primers used were as follows:

Forward 5′-GGATTGAACAAGGACGCATTTCCCC 3′ and

Reverse 5′- TTGCACATTGCATTCCCAAAGACCC 3′.

PCR was run for 40 cycles at 63°C annealing temperature. Digestion with FokI restriction endonuclease (Fast Digest-Thermo Scientific FokI, Catalog number: FD2144) produced two fragments of 215 and 165 bp only when the ATG triplet coding for isoleucine was present. Then the amplification products (10 µl) were separated by electrophoresis through 2% agarose gel stained with ethidium bromide and visualized under ultraviolet light. A 50-bp Ladder was used. If the person was homozygous for the mutation (A/A), there would be two fragments of 215 and 165 bp on the gel. If the person was heterozygous (G/A), there would be three fragments at 380, 215, and 165 bp. If there was no mutation (G/G), there would be only one 380-bp fragment

The biochemical parameters

Urea, creatinine, random blood sugar, total cholesterol, high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, triglycerides, and albumin were measured using routine methods on a Hitachi 971 instrument (Roche Diagnostics, Mannheim, Germany).

Statistical analysis

Statistical calculations were performed using ‘SPSS software package/version 15.0’ (SPSS Inc., Chicago, Illinois, USA). Parametric numerical variables were presented as mean±SD, and differences between groups were compared using Student’s t test and analysis of variance test for parametric variables. Differences between cases and controls regarding the distribution of CCR2 polymorphisms were tested using χ2 and Fisher exact tests. The results were considered significant whenever P values less than 0.05 were observed.


  Results Top


The results of the present study showed no significant difference between ESRD patient group and controls regarding age and sex distribution (P>0.05). However, there was a significant difference in serum levels of cholesterol, triglycerides, low-density lipoprotein, urea, and creatinine between the patients and controls, as shown in [Table 1]. The frequency of CCR2-641 genotypes GG, AG, and AA in the patient group was 65.7, 25.7, and 8.6%, respectively, in comparison with 81.0, 14.3, and 4.8%, respectively, in the group of controls. There was no significant difference in the genotype frequency distribution of CCR2-641 in patients and controls. Moreover, the frequencies of A and G alleles did not differ significantly between the two groups. The frequency of G and A alleles was 55 (78.6%) and 15 (21.4%) in the patient group in comparison with 37 (88.1%) and five (11.9%) in the controls, as evident from [Table 2]. The polymorphism was not significantly associated with the presence of hypertension or diabetes mellitus, as seen in [Table 3]. The time from diagnosis of kidney disease to the onset of ESRD was significantly shorter for patients carrying the genotypes AA and G/A than the genotype G/G, as seen in [Figure 1].
Table 1 Demographic and clinical characteristics of studied groups

Click here to view
Table 2 Genotype and allele frequencies of chemokine receptor 2-641polymorphism among the two studied groups

Click here to view
Table 3 Genotype distribution of chemokine receptor 2-641polymorphism in patients regarding presence of hypertension and diabetes mellitus

Click here to view
Figure 1 CCR2-V64I genotypes and progression to ESRD in dialyzed patients. (P<0.001). CCR2, chemokine receptor 2; ESRD, end-stage renal disease.

Click here to view



  Discussion Top


In ESRD, active leukocytes mainly macrophages originating from blood monocytes and expressing CCR2 permeate the renal tissues. They produce pro-inflammatory and pro-fibrotic cytokines which attract more leukocytes, resulting in fibrosis and tubular damage [14]. Studying chemokines and their receptors that are responsible for kidney damage paves a new therapeutic way for the treatment of progressive renal failure [15]. To investigate the role of chemokines in the pathogenesis of renal inflammation, different animal models were used to block chemokine activity with chemokine receptor antagonists, neutralize antibodies, and interrupt genes encoding chemokines and their receptors [16]. Blocking CCR2 decreased infiltration and activation of macrophages in the diseased kidneys and was considered beneficial for progressive fibrosis [17]. The CCL2/MCP-1 neutralizing antibodies were found to reduce macrophage glomerular infiltration in rat anti-Thy-1.1 nephritis [18]. Administration of antibodies against CCL2/MCP-1 was found to lower proteinuria and monocyte infiltration in rat nephrotoxic serum nephritis [19].

Total cholesterol, triglycerides, and low-density lipoprotein were significantly higher in the patient group than in the control group, whereas high-density lipoprotein was significantly higher in the control group. Chemokine signals are understood to be responsible for the development of progressive atherosclerosis and nephropathy [20]. Several cytokines and lipoproteins are known to enhance CCR2 and CCR5 expression by monocytes and the vascular wall smooth muscle cells, signifying the role of CCR-mediated signals in the development of atherosclerosis [21].

The risk of atherosclerotic cardiovascular disease is enhanced in patients with CKD [22]. Macrophages have crucial roles in all stages of atherosclerotic lesion development through their inflammatory role and lipid homeostasis [23]. Subintimal retention of atherogenic lipoproteins in the arterial wall aggravates the production of leukocyte chemoattractant molecules. Chemokines and chemokine receptors have been linked to the migration of T cells and monocytes into the arterial intima [24].

In the current study, the frequency of CCR2-641 genotypes GG, AG, and AA in the patient group was 65.7, 25.7, and 8.6%, respectively, in comparison with 81.0, 14.3, and 4.8%, respectively, in the control group. Consequently, the patient group showed a higher frequency of AG and AA genotypes and a lower frequency of GG genotype than the control group, but the differences were not found to be significant.

Conversely, another study revealed a clear significant association between CCR2 G190A and CRF risk, especially the AA genotype and A allele. There was a significant correlation between the polymorphism and the presence of diabetes mellitus [25].

A similar study showed that there was a highly significant prevalence of CCR2-V64I genotypes GA and AA as well as A allele in patients with ESRD compared with healthy controls, advocating that the A allele might be the responsible allelic variation that leads to ESRD in children with CKD and is regarded as a risk marker for its development. They also stated that the CCR2-64I A allele may play a pivotal role in acute graft rejection in these patients, and the complex of CCR2-64I and its ligand MCP-1 might stimulate the passage of monocytes into the transplanted kidney [13]. Another comparable study reported a highly significant frequency of the CCR2-V64I AA genotype in patients with chronic renal failure compared with that in healthy participants, and this might be related to the severity of CRF, especially in the cases with chronic disease. Those results showed that ‘later in renal injury, CCR2 is the only chemokine receptor expressed by inflammatory cells’ [3].

In agreement with our results, the association of SNPs from the genes ‘CCR5, CCR2, TNFα and TGFβ1’ between individuals with type 2 diabetes mellitus with and without chronic renal insufficiency was examined. A significant association was found between 59029 G>A SNP of CCR5 gene and CRI. The allele 59029 A seems to be attributed to diabetic CRI, whereas no association has been detected between Val64Ile and CRI [26]. The same results were obtained by another study that evaluated the correlation between each of the CCR5 promoter region 59029 G/A genotype and CCR2-V64I genotype with diabetic nephropathy. They reported that ‘no association of CCR2-V64I genotype with nephropathy was found, whereas there was a significant prevalence of CCR5 59029 A-positive genotype in the groups that had microalbuminuria or macroalbuminuria compared with the normoalbuminuric group’ [21]. On the contrary, there was no significant modification in either CCR2 and CCR5 polymorphisms between 25 children with biopsy proven focal segmental glomerulosclerosis and 40 healthy controls [27]. In a study aiming to investigate urinary MCP-1, V64I polymorphism in the CCR2 gene and the −2518 A/G polymorphism in the MCP-1 gene were both found to be prognostic indicators of disease activity. They found that ‘MCP-1 levels increased in a statistically significant manner in patients with active disease as well as patients with kidney insufficiency’. Homozygous −2518A polymorphism was found to be linked to a more severe outcome and higher levels of urinary MCP-1. No such relationship was found as regards CCR2-V64I [28]. In the current study, no significant associations were found between CCR2 genotypes and either diabetes mellitus or hypertension. This was in accordance with another study whose results showed that in the study group the presence of diabetes mellitus, hypertension, and atherosclerosis did not affect the results [3]. In another study, the aforementioned polymorphism was significantly associated with the presence of diabetes mellitus; however, the same polymorphism was not significantly associated with the presence of hypertension [25]. The time from diagnosis of kidney disease to the onset of ESRD was significantly shorter for patients carrying the genotypes AA and G/A than the genotype G/G, indicating significant association between CCR2 genotypes and the rate of progression to ESRD. Other studies showed that rapid deterioration to ESRD was associated with ACE-DD genotype and AT1R-CC genotype [29],[30]. Hence, the current insignificant results in genotype and allele frequency distribution of CCR2-64I in ESRD may be owing to a relatively small sample size.

Studying the genetic polymorphism of CCR2 and the effects of CCR2-V64I polymorphism on the development and progression of ESRD is still debatable. It is important to study the effects of combined polymorphisms of more than one gene on the pathogenesis and progression of CKD. Genetic polymorphism of CCR2-V64I could synergize with the angiotensin-converting enzyme I/D polymorphism in influencing the risk of DN and the response to renoprotective treatments in patients with type 2 diabetes. The carriers of both ‘risk’ genotypes DD and VI/II are at a bigger risk of developing microalbuminuria in comparison with carriers of both protective genotypes [31].


  Conclusion Top


The CCR2-V64I gene polymorphism may play a role in the progression and severity of ESRD in Egyptian patients. The current results are promising in elaborating this role. Moreover, other chemokines and chemokine receptors in diverse chronic renal diseases need to be explored.

Limitations and recommendations

Our study had some limitations, including the small sample size, owing to financial issues. So we recommend further investigations to be carried out on larger population-based studies.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Griffith JW, Sokol CL, Luster AD. Chemokines and chemokine receptors: positioning cells for host defense and immunity. Annu Rev Immunol 2014; 32:659–702  Back to cited text no. 1
    
2.
You H, Gao T, Raup-Konsavage WM, Cooper TK, Bronson SK, Reeves WB, Awad AS. Podocyte-specific chemokine (C-C motif) receptor 2 over expression mediates diabetic renal injury in mice. Kidney Int 2017; 91:671–682.  Back to cited text no. 2
    
3.
Sezgin I, Koksal B, Bagci G, Kurtulgan HK, Ozdemir O. CCR2 polymorphism in chronic renal failure patients requiring long term hemodialysis. Intern Med 2011; 50:2457–2461.  Back to cited text no. 3
    
4.
Segerer S, Nelson PJ. Chemokines in renal diseases. Sci World J 2005; 5:835–844  Back to cited text no. 4
    
5.
O’Connor T, Borsig L, Heikenwalder M. CCL2-CCR2 signaling in disease pathogenesis. Endocr Metab Immune Disord Drug Targets 2015; 15:105–118.  Back to cited text no. 5
    
6.
Ferreira-Fernandes H, Santos A, Motta F, Canalle R, Yoshioka FK, Burbano R et al. Prevalence of CCR5Δ32 and CCR2-V64I polymorphisms in a mixed population from northeastern Brazil. Genet Mol Res 2015; 14:11710–11718.  Back to cited text no. 6
    
7.
Manchanda PK, Singh R, Mittal RD. Cytokine (IL-10 _1082 and _819) and chemokine receptor (CCR2 and CCR5) gene polymorphism in north indian patients with end-stage renal disease. DNA Cell Biol 2009; 28:177–183.  Back to cited text no. 7
    
8.
Vianna HR, Soares CM, Tavares MS, Teixeira MM, Silva AC. Inflammation in chronic kidney disease: the role of cytokines. J Bras Nefrol 2011; 33:351–364.  Back to cited text no. 8
    
9.
Blanche Ch, Rulan S. Progression in chronic kidney disease. Adv Chronic Kidney Dis 2005; 12:353–365.  Back to cited text no. 9
    
10.
Anders HJ, Vielhauer V, Schlondorff D. Chemokines and chemokine receptors are involved in the resolution or progression of renal disease. Kidney Int 2003; 63:401–415.  Back to cited text no. 10
    
11.
Anders HJ, Vielhauer V, Kretzler M, Cohen CD, Segerer S, Luckow B et al. Chemokine and chemokine receptor expression during initiation and resolution of immune complex glomerulonephritis. J Am Soc Nephrol 2001; 12:919–931.  Back to cited text no. 11
    
12.
Hammady MMR, Mossaad N, Farhan H, Ali S. Angiotensin II type 1 receptor gene polymorphism in egyptian patients with chronic renal failure. Aust J Basic Appl Sci 2012; 6:483–488.  Back to cited text no. 12
    
13.
Elghoroury EA, Elshamaa MF, Fadel FI, Kandil D, Farouk H, Kamel S et al. CCR2 V64I Genotyping: Impact on end stage renal disease development, progression and renal transplantation outcome. JIPBS 2018; 5:05–11.  Back to cited text no. 13
    
14.
Braga T, Correa-Costa M, Silva RC, Cruz MC, Hiyane MI, da Silva JS et al. CCR2 contributes to the recruitment of monocytes and leads to kidney inflammation and fibrosis development. Inflammopharmacology 2018; 26:403–411.  Back to cited text no. 14
    
15.
Segerer S, Nelson PJ, Schlöndorff D. Chemokines, chemokine receptors, and renal disease: from basic science to pathophysiologic and therapeutic studies. J Am Soc Nephrol 2000; 11:152–176.  Back to cited text no. 15
    
16.
Rovin BH. Chemokine blockade as a therapy for renal disease. Curr Opin Nephrol Hypertens 2000; 9:225–232.  Back to cited text no. 16
    
17.
Kitagawa K, Wada T, Furuichi K, Hashimoto H, Asano M, Ishiwata Y et al. Blockade of CCR2 ameliorates progressive fibrosis in kidney. Am J Pathol 2004; 165:237–246.  Back to cited text no. 17
    
18.
Wenzel U, Schneider A, Valente AJ, Abboud HE, Thaiss F, Helmchen UM, Stahl RA. Monocyte chemoattractant protein-1 mediates monocyte/macrophage influx in anti-thymocyte antibody-induced glomerulonephritis. Kidney Int 1997; 51:770–776.  Back to cited text no. 18
    
19.
Fujinaka H, Yamomoto T, Takeya M, Feng L, Kawasaki K, Yaoita E et al. Suppression of anti-glomerular basement membrane nephritis by administration of anti-monocyte chemoattractant protein-1 antibody in WKY rats. J Am Soc Nephrol. 1997; 8:1174–1178.  Back to cited text no. 19
    
20.
Reape TJ, Groot PH. Chemokines and atherosclerosis. Atherosclerosis 1999; 147:213–225.  Back to cited text no. 20
    
21.
Nakajima K, Tanaka Y, Nomiyama T, Ogihara T, Piao L, Sakai K et al. Chemokine receptor genotype is associated with diabetic nephropathy in Japanese with type 2 diabetes. Diabetes 2002; 51:238–242.  Back to cited text no. 21
    
22.
Kon V, Linton MF, Fazio S. Atherosclerosis in chronic kidney disease: the role of macrophages. Nat Rev Nephrol 2011; 7:45–54.  Back to cited text no. 22
    
23.
Glass CK, Witztum JL. Atherosclerosis: the road ahead. Cell 2001; 104:503–516.  Back to cited text no. 23
    
24.
Peters W, Charo IF. Involvement of chemokine receptor 2 and its ligand, monocyte chemoattractant protein-1, in the development of atherosclerosis: lessons from knockout mice. Curr Opin Lipidol 2001; 12:175–180.  Back to cited text no. 24
    
25.
Elhelbawy NG, Elzorkany KM, Abdelatty AF. Chemokine receptor 2 (CCR2) G190A polymorphism in chronic renal failure patients requiring hemodialysis. Egypt J Biochem Mol Biol 2016; 34:67–76.  Back to cited text no. 25
    
26.
Prasad P, Tiwari AK, Kumar KM, Ammini AC, Gupta A, Gupta R, Thelma BK. Association of TGFbeta1,TNFalpha, CCR2 and CCR5 gene polymorphisms in type-2 diabetes and renal insufficiency among Asian Indians. BMC Med Genet 2007; 12:8–20.  Back to cited text no. 26
    
27.
Bıyıklı NK, Alpay H, Bozkurt N, Gokce I, Ozdemir N, Sbir T. Chemokine receptor 2 and chemokine receptor 5 polymorphisms in nephrotic patients. Adv Mol Med 2006; 2:165–170.  Back to cited text no. 27
    
28.
Jönsson N, Erlandsson E, Gunnarsson L, Pettersson A, Ohlsson S. Monocyte chemoattractant protein-1 in antineutrophil cytoplasmic autoantibody-associated vasculitis: biomarker potential and association with polymorphisms in the mcp-1 and the cc chemokine receptor-2 gene. Mediators Inflamm 2018; 2018:6861257.  Back to cited text no. 28
    
29.
Lovati E, Richard A, Frey BM, Felix J, Frey FJ, Ferrari P. Genetic polymorphisms of the renin-angiotensin-aldosterone system in end-stage renal disease. Kidney Int 2001; 60:46–54.  Back to cited text no. 29
    
30.
Buraczynska M, Ksiazek P, Drop A, Zaluska W, Spasiewicz D, Ksiazek A. Genetic polymorphisms of the renin-angiotensin system in end-stage renal disease. Nephrol Dial Transplant 2006; 21:979–983.  Back to cited text no. 30
    
31.
Alkhalaf A. Novel approaches in diabetic nephropathy. Groningen: 2013; 166.  Back to cited text no. 31
    


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
   Abstract
  Introduction
  Patients and methods
  Results
  Discussion
  Conclusion
   References
   Article Figures
   Article Tables

 Article Access Statistics
    Viewed499    
    Printed33    
    Emailed0    
    PDF Downloaded77    
    Comments [Add]    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]